From Molecules to Memory -
Expression Mechanisms and Behavioural Correlates of Long-Term Potentiation (LTP)

The proposal concentrates on a central biomedical problem: the nature of nerve cell changes underlying learning and memory. The objectives are to elucidate the molecular changes occurring in the coupling between nerve cells taking part in a learning process. The objectives will be achieved by assessing the behavioural correlates of a cellular model of learning - long-term potentiation (LTP) - in the belief that this phenomenon represents a biological universal used by higher and lower animals. In spite of extensive effort, a clear relation between LTP and behaviourally induced learning is still lacking, largely due to the absence of convincing learning tests. In addition to behavioural assays, the project will employ state-of-the-art electrical and optical imaging techniques to determine the biophysical properties of the synapses involved. The molecular alterations of these nerve cells lie at the foundation for new ways to diagnose, prevent, and possibly treat learning and memory defects.

BACKGROUND MATERIAL

Attempts to establish the relationship between brain structure, activity, and function typically follow either of two generic approaches. The first is correlative: for example, this could seek to show how a particular function is correlated with patterns of neuronal activity in the brain. The limitations of these kinds of studies lie in their inability to demonstrate causal relations: to do this, manipulative studies are needed. These may show whether or not a structure or activity is necessary for a particular function. A classical manipulative approach is to make a lesion that destroys a particular target area in the brain. Lesion experiments have clearly shown selective memory impairments in rats, monkeys, or humans with hippocampal damage (Squire, 1991). Selective lesions confined to parts of the hippocampus also produce clear impairments, particularly in spatial memory (O'Keefe and Nadel, 1978). The key development in manipulative studies has been to increase the selectivity of the lesion, to damage the target area as completely as possible while causing the minimum damage to other, nearby areas. Nonetheless, however good the lesion technique, it is only one of several possible methods. More compelling evidence are likely to be derived from approaches that combine different methodologies while addressing the same issue.

The introduction of genetic engineering techniques to manipulate the genes that code for particular proteins has brought a new level of accuracy to manipulative approaches. By manipulating the right targets, experimenters can analyse the neural substrates of behaviour and cognition more precisely than ever before. The present project will use genetic engineering techniques to evaluate the neural substrate of learning and memory. In doing so the project will concentrate on the role of a specific neurotransmitter, namely the excitatory transmitter glutamate. At the majority of cortical synapses the glutamate binds to two ionotropic receptors with the acronyms AMPA and NMDA. While AMPA receptors mediate the standard impulse traffic between neuronees, the NMDA receptors have special roles during development and activity-dependent synaptic changes, effected through their ability to let calcium ions into specific postsynaptic sites. Both receptors are large, multi-component protein molecules which can be assembled in various ways to give variants with different properties. The AMPA receptor is a tetramer, a combination of four monomer molecules. Four different monomer types or GluR-A-D subunits, each coded for by a separate gene, are available for the assembly. A basic form of increased synaptic efficacy is due to an enhanced current through AMPA receptors.

Work carried out in Per Andersen's laboratory almost thirty years ago demonstrated that hippocampal neurones are sensitive to the history of previous activity (Bliss and Lømo, 1973). A brief high-frequency train of stimuli (a tetanus) increased the amplitude of the excitatory postsynaptic potential (EPSP) in target neurones. This facilitation is called long-term potentiation (LTP). LTP has the essential properties to explain learning - long duration, physiological induction, and associative properties. Such an electrophysiological phenomenon had long been sought as a potential neural substrate of memory formation. Subsequent pharmacological manipulations indicated that treatments that prevent the hippocampus from showing LTP also prevented the normal formation of spatial memories (Morris et al. 1986). Successful LTP induction requires synaptic activation of a sufficiently depolarised dendritic spine, leading to local calcium influx, which initiates LTP expression. However, the nature of the expression mechanism of LTP is not fully known. Recently, manipulation of the AMPA receptor at the the molecular level has efficiently interfered with the processes underlying changes in synaptic efficacy. Further analysis of these processes will, hopefully, enable us to understand how LTP, and in turn, how memory, is formed.

The relation between hippocampal LTP and hippocampus-dependent learning and memory functions is not unequivocal. There is a correlation between the time course of dentate LTP and ability to learn new tasks (Barnes, 1988), and the rate of forgetting a spatial task (Barnes, 1979). Further, blocking LTP in dentate perforant path synapses with 2-amino-5-phosphono-pentanoate (AP5) abolishes water maze learning (Morris et al., 1986). However, although spatial training may give LTP-like changes in dentate field potentials, the effect lasts less than 30 minutes (Moser et al., 1994). Moreover, attempts to interfere with spatial learning by saturation of LTP have given variable results (Bliss and Richter-Levin, 1993, Korol et al., 1993, Jeffery and Morris, 1993, Sutherland et al., 1993, Cain et al., 1993, Moser et al., 1998). Additionally, Bannerman et al.(1995) showed that prior spatial pretraining abolished the effect of AP5 on spatial learning tests in a new environment. Finally, the relative importance of CA1 and dentate LTP for learning is unknown. The present project is a fresh attack on these issues using the new and powerful technology of genetic engineering.

The central problem under investigation in this project is the nature and function of hippocampal synaptic plasticity. More specifically, the project intends to probe into the question of how the AMPA molecule is altered to execute critical changes at synapses that may support behavioural learning. Our main hypothesis is that a molecular alteration of glutamate AMPA receptors lies at the heart of activity-dependent synaptic changes as seen in LTP expression. The project takes as its starting point a new and fundamental finding made by a Heidelberg/Oslo collaboration: In mice lacking the gene for the GluR-A subunit (GluR-A-/-), AMPA receptors are probably composed of GluR-B-D subunits only. Although the excitatory dendritic synaptic transmission is normal in such mutants, they can not produce LTP in the CA1 field of the hippocampus (Zamanillo et al., 1999). Thus, we can conclude that the alterations point to an essential step in LTP expression. In spite of this failure of LTP, the GluR-A-/- mice show adequate learning in the basic reference memory version of the Morris water maze. It is not certain whether this failure was due to a real learning deficit, whether the test was too unspecific or whether sensory, motor, motivational, attentional or emotional factors were responsible. Moreover, recent experiments carried out by the applicant in the Oxford laboratory have found a pronounced spatial working memory (or temporary memory) deficit in the elevated T-Maze. While some types of memory may be spared in the deletion of LTP related AMPA activity, other types of memory may not be. In light of this, the data demand a re-investigation of the relation between LTP and different types of learning and memory.

PLANNED ACTIVITIES
OBJECTIVES
The general objectives of the project are to use molecular, behavioural, and electrophysiological tests to analyse the nature synaptic changes that may underlie learning. The work will concentrate on hippocampal glutamate receptors, which are necessary for the development of long-term potentiation. Glutamate also participates in excitotoxic cell death, which almost certainly plays a part in several common neurodegenerative conditions. Hence the work potentially bears simultaneously on ways in which memory is normally stored in the brain; on possible underlying causes of abnormal memory storage and conceivably epilepsy; and on our understanding of Alzheimer's disease. The long-term goal is to provide a molecular background for a rational development of methods and compounds, which may help in prevention, diagnosis and treatment of learning and memory deficits as well as other brain pathologies.

The specific objectives of the project are to use precise molecular manipulations of LTP expression to study the relationship between LTP and memory formation. In particular, we will re-assess the evidence that GluR-A-/- mice that show no LTP in hippocampal area CA1 nonetheless show normal spatial memory in the water maze (Zamanillo et al., 1999). There are three possibilities:
(i) The water maze paradigm employed was insufficiently sensitive to hippocampal dysfunction;
(ii) Spatial memory performance was supported by LTP elsewhere in the hippocampus (e.g. in the
dentate gyrus);
(iii) Hippocampal LTP is not necessary for normal spatial memory function.
Our project is designed to choose between these options, by (a) Extending the range and sensitivity of behavioural testing of the knockout mice; (b) Determining whether or not LTP is present in the dentate gyrus despite being absent in CA1. Additional experiments will investigate memory functions that depend on extra-hippocampal structures in which the knockout will also have eliminated GluR-A subunits (notably the amygdala and olfactory bulb).

METHOD
The present project will use several different ways of investigating the fundamental phenomenon of synaptic plasticity. The main method is to construct a set of genetically altered mice and test biophysical, behavioural and physiological consequences of these genetic manipulations. Before the start of the project, the applicant will take part in the engineering of these mice. ŒPrimarily, the work will entail the establishment and testing of a battery of behavioral tests for mice. This will include not only well-established tests, but also new procedures specifically developed to be both sensitive and reliable indicators of brain damage in mice. In addition to tests of cognition, the project will include assays of motivation, motor coordination, and emotionality. This part of the project will take place in Oxford under the supervision of Nick Rawlins, during the first year of the project. �In addition, the applicant will employ electrophysiological experiments in order to determine the extent to which the capacity of the knockout mice for synaptic plasticity has been altered. This aspect of the study will be carried out in Oslo under the supervision of Per Andersen, during the second year of the PhD. ŽFinally, the project will involve the use of optical imaging techniques to estimate the altered biophysical properties of the synapses affected. Time permitting, this part will be undertaken in Heidelberg under the supervision of Bert Sakmann, during the first quarter of the last year of the PhD. The project thus builds in the principle of triangulation, approaching the same question from different perspectives. Over and above that, the genetic manipulations themselves will give an element of triangulation since they will compare the effects of conventional knockout animals, site-specific knockout animals, and animals with tissue-specific, experimenter-determined knockouts.

Construction of GluR-A Mutants (Germany)
The project timetable (see Appendix, p. 10) contains a systematic set of experiments to investigate the essential molecular changes responsible for LTP in a set of mice produced by Peter Seeburg's laboratory at the Max-Planck-Institute for Medical Research (MPImF) in Heidelberg :
(i) GluR-A-/-, with deletion of the gene for the AMPA type A subunit to analyse the development and
compensation of LTP, in addition to further characterize the learning abilities of such mutant;
(ii) GluR-AR/R, in which the glutamine in the pore region of the GluR-A subunit will be replaced by
arginine by Cre/lox technique and a codon change in exon 10;
(iii) GFP-tagged GluR- A-/-, which expresses GluR-A tagged with GFP (and beta-galactosidase). By
combining this double transgenic mutant with the GluR-A knockout genotype, we now have
a mouse model in which the experimenter can regulate CA3 à CA1 LTP. The incorporation of
GFP-tagged AMPA receptors into hippocampal CA1 pyramidal cell synapses may be monitored
by fluorescence microscopy.

The first knockout type is already available. In this mouse, the GluR-A targeting vector pFC II contains 10.7 kb of the GluR-A gene (GRiA I) encoding parts of intron 10, intron 11 and exon 10. Exons are assigned according the GluR-B gene homology. A neo selection marker is inserted into a EcoNI site 700 bp downstream from exon 10. In addition, 225 nucleotides upstream of exon 10, a 28 bp PflMI fragment, is substituted by a 34 bp loxP site. Embryonic stem cells are electroporated with the targeting vector and linearised at the unique Hind III site in the polylinker. Positive clones are identified by PCR analysis with P1 sense (TCTCATTGTGATGGACCCATCC) and P2 antisense (CTGCCCATGAATAATAACTTCG) primers, and confirmed by Southern blotting of BamHI digested genomic DNA . As 5' outside probe a 162 bp Sac I fragment of the mouse GluR-A intron 10 is used. ES cell clones are transfected with an expression vector for CRE recombinase (pMC-Cre) and clones with one loxP site are identified by PCR of ES cell DNA with P1 sense and P3 antisense (CTGCCTGGGTAAAGTGACTTGG) primers. Subclones are injected into C57Bl6 blastocysts to generate germline transmitting chimaeric animals and backcrossed to C57Bl6 for one generation. The resulting F2 generation is intercrossed to produce GluR-A-/- mice at a Mendelian ratio of 25%. The identity of GluR-A genotypes is confirmed by Southern blot analysis and PCR analysis with primers P1 and P3. F2 cohorts of this mouse type have already been tested on various behavioural paradigms in Oxford during the last 9 months.

The second genetically modified mouse type is a GluR-AR/R mouse, which expresses a GluR-A subunit mutated at a single amino acid position in the pore region of the channel. The mutation changes a glutamine codon in position 602 to an arginine codon. It is expected to have a dominant effect on channel assembly and mediates impermeability for divalent ions through the AMPA receptor channel. In mice which carry this mutation the heteromeric AMPA receptor channel assemblies can be expected to be composed of GluR-B/GluR-C and GluR-A(R)/GluR-C subunits. GluR-B/GluR-A(R) assemblies are not expected since GluR-B carries an arginine in the channel segment and subunits containing arginine in position 602 co-assemble poorly. Thus, as in the GluR-A-/- mice the amount of the GluR-C subunit determines the amount of synaptically located AMPA receptors. In contrast to GluR-A-/- mice, however, in the GluR-AR/R mice the backbone of the GluR-A subunit participates in synaptically localized AMPA receptors. If the presence of GluR-A is of importance, then we may find LTP in these animals despite the fact that the number of AMPA receptors in CA1 cells is just as strongly reduced as in GluR-A-/- mice. These mice are made by gene targeting of embryonic ES cells. The targeting vector is like the targeting vector for the GluR-A gene described above. A loxP doubly flanked neo selection marker is inserted in intron 11. Together with diagnostic nucleotide exchanges in exon 10 and a change of the glutamine codon to an arginine codon, a third loxP site is positioned in intron 10. Manipulated ES cells are identified by PCR and confirmed by Southern blotting. Positive clones are amplified and transfected by Cre expression plasmid and subclones in which the neo gene has been removed by the Cre treatment are identified by PCR analysis and injected into blastocysts in order to obtain mice with the modified GluR-A(R) allele. Heterozygous GluR-A+/R mice are used to determine the expression level of the modified GluR-A(R) allele relative to the wild-type GluR-A+ allele and are used to obtain homozygous GluR-AR/R mutants.

The third genetically altered animal is a mouse mutant harbouring in its genome a bi-directional construct for a GFP-tagged GluR-A subunit and for the indicator gene lacz. Both genes are under the common control of minimal promoters with an intervening set of tet operators. The promoters are thus linked in their responsiveness to transcriptional activation by the tetracycline repressor-VP16 transactivation domain fusion (tTA), and such activation can be suppressed in presence of tetracycline and certain derivatives such as doxycycline (dox). These transgenic mice are crossed with transgenic mice expressing tTA in specific regions of the brain, such as the line described by Mayford et al., 1995, in which tTA is under the transcriptional control of the CaMKII promoter. In double-transgenic mutants, the GFP-tagged GluR-A subunit, and beta-galactosidase, will be expressed in a dox-regulated manner in forebrain principal excitatory neurones. By combining this double transgenic mutant with the GluR-A knockout genotype, we made available a mouse model in which we can regulate the amount of GluR-A in the CA3/CA1 neurones, and, thereby, influence LTP in their connecting synapses.

Behavioural Analysis (UK)
Nicholas Rawlins' laboratory at the University of Oxford has a long track record of successful development of behavioural tests of memory and cognition in rodents. It participated in the first demonstration that hippocampal damage impaired spatial memory performance in the water maze (Morris et al., 1982). The procedure has become an established international standard for assessing hippocampal impairment, and it is this connection that the study by Zamanillo et al., 1999, challenges. The laboratory also established the T-maze working memory task as the alternative index of choice for measuring hippocampal dysfunction (Rawlins and Olton, 1982). Researchers in the laboratory have recently shown that performance in both tasks depends on dorsal but not ventral hippocampal function (Bannerman et al., 1999), confirming and extending earlier studies (Moser et al., 1995). This and a companion paper demonstrated the first double dissociation of dorsal and ventral hippocampal function (Richmond et al., 1999). The laboratory introduced the two lever delayed match/non-match to sample task as an automated version of the T-maze working-memory task (Rawlins and Tsaltas, 1983). It conducted the first assessment in rodents of the effects of hippocampal damage on object recognition memory (Aggleton et al., 1986), and published the first report of hippocampal lesion-induced deficits in contextual conditioning (Winocur et al., 1987). Moreover, it has recently built up experience with learning tests in mice. They published a novel demonstration of the early, pre-clinical effects of hippocampal scrapie infection (Betmouni et al., 1999) and demonstrated selective mnemonic effects of ageing in mice (Marighetto et al., 1999). The laboratory's most senior post-doc, Robert Deacon, recently demonstrated that environmental enrichment could be used to retard the appearance of CNS dysfunction in transgenic Huntington mice (van Dellen et al., 2000).

The primary aim of this grant proposal is to test the hypothesis that LTP-like forms of synaptic plasticity in the hippocampus may underlie hippocampus-dependent forms of learning. A clear prediction of this hypothesis is that animals which are deficient in hippocampal LTP should be impaired on behavioural tasks which require the hippocampus i.e. for our purposes that is tasks that are sensitive to hippocampal lesions. Clearly, the previously published observation that GluR-A-/- mice are capable of solving a spatial reference memory task in the water maze despite demonstrating a block of CA1 LTP (Zamanillo et al., 1999) is at odds with the hippocampal LTP/spatial learning hypothesis. However, spatial memory can be assessed in other ways than the water maze. In the past nine months, on a temporary student grant made available by Professor Per Andersen in Oslo, the applicant has already started to investigate other ways of testing the spatial working memory performance of the GluR-A-/- mice. We attempted to ascertain whether the lack of impairment found by Zamanillo et al., 1999, is specific to the aversively motivated water maze or whether it extends to the appetitively motivated Y-maze spatial reference memory task. First, we wanted to demonstrate that cytotoxic hippocampal lesions did in fact inhibit learning. The task proved highly sensitive to hippocampal damage, eliciting a statistically significant difference between the experimental and a control group (F(1,21)=69.65; p>0.0001). We then compared wild type and GluR-A-/- mice on the same task. By contrast, we found no significant difference between the groups (F<1; p>0.50). These results indicate that the initial conclusions regarding the behaviour of the LTP-deficient GluR-A-/- mice in the Morris water maze can be extended to the Y-maze. Similarly to the water maze, this task relies on the ability to learn and retain spatial information, yet it differs in terms of sensorimotor and motivational demands. The applicant will communicate these finding at the Annual Meeting of the Society for Neuroscience in San Diego, California, in November 2001.

In order to test the performance of the animals on a working memory task, we employed an appetitively motivated spatial working memory procedure (so-called rewarded alternation or spatial non-matching to position) using the elevated T-maze. Whereas the spatial reference water maze task requires the animal to retain spatial information over several days, performance on the T-maze is only dependent on temporary storage of information. In this task, mice are forced left or right down one arm of the T-shaped maze where they receive a small amount of sweetened condensed milk. Then, they are immediately given a free choice of either arm of the maze, and are rewarded for choosing the previously unvisited arm (i.e. for alternating). Whereas wild type mice performed well on this task (over 80% correct over 40 trials), the GluR-A-/- mice performed at chance (49% correct). At first glance, this finding contradicts the Zamanillo water maze study, which showed that the knockout mice were capable of normal spatial learning. Hippocampal lesions affect both these tasks. It is not immediately clear, therefore, why such a dissociation between water maze performance and T-maze performance has arisen. One possibility is that the difference may reflect differential task sensitivity. It is known that the T-maze is a more sensitive task than the water maze for picking up hippocampal dysfunction (Bannerman et al., 1999). Another possibility is that animals deficient in LTP are capable of showing some aspects of normal spatial learning, whereas they are impaired on others. The difference in performance on the two tests might then appear because the two tasks make different demands on the cognitive system.

We also plan to employ other procedures that measures working memory both spatially and non-spatially. One such task is the Differential Reinforcement of Low Rates Task, with an interval of 12 seconds (DRL-12). In this task, subjects are required to space their responses at least 12 seconds apart: responses that meet this criterion are rewarded; early responses are not. Early reports suggested that mice perform poorly on this task (Richelle, 1972). In fact they learn it well with a nose-poke response instead of lever press and liquid reward. Septal lesion-induced impairments in DRL efficiency can be seen after minimal training (Carlson et al., 1976). In rats, damage restricted to the hippocampus alone is sufficient to impair this performance; the extent of impairment increases with hippocampal lesion size, but does not depend on intra-hippocampal lesion site (e.g. Sinden et al., 1986; Bannerman et al., 1999). Performance is also impaired by administration of AP5 (Tonkiss et al., 1989). This procedure is relevant because it could answer the question whether the deficit found in the T-Maze extends to non-spatial, hippocampal-dependent working memory tasks.

The continuing development and validation of mouse equivalents of learning tasks that were developed for rats is strategically important to the project. The need for functional analyses of behaviour in mice, particularly genetically manipulated subjects, is expected to grow in the coming years. The range of potential tasks will therefore itself expand. We will continually refine our test battery in the light of experience, to exclude tasks giving poor performance in controls, or inconsistent results with low effect sizes for our manipulations of interest. A number of issues need to be resolved, and these issues form the basis of our immediate future experiments. The inclusion of the two other transgenic animal types will be of help in elucidating the issues. Especially interesting is testing of the experimenter-determined GFP-tagged knockout mice on the T-maze. Since the GluR-A-/- knockouts elicit such a marked deficit in temporary memory, it would be of great importance to be able to manipulate this freely by dox-withdrawal.

Electrophysiological Analysis (Norway)
In Per Andersen's laboratory at the University of Oslo, the applicant will apply a range of physiological tests on several types of transgenic mice which have been generated or are in the process of being generated. The Andersen laboratory has an international reputation for work on the hippocampus, particularly those related to synaptic plasticity and has pioneered the use of the transverse hippocampal slice since 1971. The laboratory has long experience in cellular recordings (sharp and patch electrodes) from hippocampal neurones, intracellular injections (enzyme fractions, blockers, drugs, fluorescent markers), spine detection, counting, and reconstruction. Two well equipped laboratories are available for the experiments, and one for confocal microscopical work. Professor Andersen and his colleagues will supervise the work, which will entail standard electrophysiological experiments on hippocampal slices with special emphasis on LTP tests of the GFP-tagged GluR-A-/- mice, GluR-C-/- mice and wildtype animals at different ages.

In particular, the work will include the testing for presence of LTP in the CA1 region and the dentate gyrus. The recordings will be made both intra- and extracellularly. Potentiation will be made by tetanic stimulation, theta burst stimulation or a pairing protocol. The ability of these protocols to distinguish between LTP properties in wild type and mutant mice will be determined. The efficacy of induction will be ensured by experiments with blockers of GABAA-mediated inhibition and by recording the voltage integral of the field and intracellular EPSPs during the tetanus. These techniques should allow us to achieve a major objective, namely to show how a specific molecular alteration of AMPA receptor molecules influences the degree and synaptic location of LTP expression. The applicant plans to continue and expand the analysis of the forebrain-restricted, GFP-tagged GluR-A-/- mice. With this reversible system, the Andersen laboratory has already been able to rescue GluR-A deficiency and restore cellular LTP in the CA3 à CA1 connection. The work will entail further investigation of the expression profile of the GFP-GluR-A fusion protein as well as analysis of cellular distributions at different stages in the animal's development. The experiments will, among other goals, probe the development of the LTP condition, and the possible presence of LTP in the dentate gyrus

The studies will relate hippocampal functional properties to the earlier behavioural tests of memory and cognition. Altogether, the work in Oslo is estimated to last for the duration of the second year. This will be an important step towards insuring the transferral of skills and techniques and the integration of the applicant into the Norwegian Neuroscience Community.

Intrinsic Optical Imaging of Synaptic Activity (Germany)
Bert Sakmann's laboratory at the Max-Planck-Institute for Medical Research (MPImF) in Heidelberg has many years of experience in characterising electrophysiologically and optophysiologically excitatory synaptic transmission in brain slices at the level of unitary connections. Sakmann received the Nobel Prize for Medicine in 1991 for his part in the discovery of the function of single ion channels in cells by his development of the patch-clamping technique. His laboratory will provide the expertise and the facilities to optically image the AMPA receptors, primarily but not exclusively, in the olfactory bulb. Researchers in Sakmann's group have recently improved existing optical imaging techniques with low level CCD-cameras in order to detect dendritic calcium transients using calcium indicator dyes. In general, the work will entail the recording of optical signals from individual dendritic synapses. This component of the project will relate olfactory bulb physiology to olfactory memory. The applicant has relevant experience in this area from previous optical imaging work of the rat visual cortex with Colin Blakemore in the Department of Physiology, Oxford.

The work in Heidelberg is to a certain extent optional and will only occur if the time permits it. Because of the techniques available in this laboratory, it would certainly strengthen the project. We estimate that this part of the project will take approximately three months. Since it is likely to occur only in 2003, an invitation will be available for the NRF closer to that time.

Expected Achievements
At the end of the project period, we expect to have definite answers to some of the key questions of LTP expression. These will include a definitive behavioural profile on the learning ability and determination of the presence or absence of LTP in the dentate gyrus and olfactory bulb of the three mutant types. We will know whether it is possible to produce a mouse in which we can regulate LTP expression, a tool which, coupled with the capacity to identify cells with the genetic construct using GFP tagging, will be an extremely valuable instrument for further memory research. Finally, we expect that our experience with behavioural tests for genetically altered mice should prove of value for further studies in the area.

ETHICS
At present, work on the relationship between brain activity and mental states cannot be simulated. Computational models are designed to try to capture the phenomena described in extant empirical observations. The work described in this proposal is essentially concerned with generating this empirical material, and so at this stage modellers track our progress rather than the converse. In vivo animal models provide a way to assess the physiological and behavioural consequences of pure cases of experimentally induced neuropathology or specific neurochemical dysfunctions, and to determine the efficacy of possible treatments for such conditions. They cannot be replaced by purely in vitro studies. Animal welfare is an important consideration, and is subject to strict legal regulation in the United Kingdom. Professor Rawlins has all the appropriate permissions to allow the work to proceed, and the applicant has passed the required UK Home Office training exams for animal maintenance, handling, and surgery. The general behaviour of the animals in the laboratory will be monitored carefully. Failures to thrive; signs of disabling motor dysfunction; or general indications of distress would be reasons to cease breeding a particular line. For our behavioural analyses to be interpretable, it is essential that our experimental subjects are in good condition overall.

Until recently, manipulative approaches have required the use of experimental interventions such as neurotoxic lesions, intracerebral infusion of specific drugs, or localised electrical stimulation of the brain, combined with sophisticated assessment of cognition to relate brain function to behaviour. Even the most selective of these techniques inevitably produces a variety of unwanted side effects, unrelated to the primary purpose of the intervention. Advances in genetic engineering techniques now mean that it is possible to make much more selective interventions, whose effects are confined to a single gene product. Selective knockouts of this kind thus represent a further refinement of methods for experimental intervention in brain function. The newly developed regulated types, employed in the present project, appear particularly useful. Such refinements may permit the neural substrate or mechanism under investigation to be studied while minimising the likelihood that the subject will experience potentially aversive or distressing side effects.

IMPLICATIONS FOR MEDICINE AND HEALTH IN SOCIETY
Diseases affecting, and impairments related to, the central nervous system represent a formidable societal problem, both within the elderly and the young population. The immense economic and social costs of high prevalence mental diseases, dementia, stroke, epilepsy, mental retardation, addictive behaviour, deviant social behaviour, dyslexia and other brain-based disorders (estimated to more than 2,500 billion NOK per year in Europe alone) represent a major problem. The costs of health care for these patients, the lost productivity at work, and the resulting human and social tensions constitute a major economic and social burden. The social cost of brain disorders and diseases is as high as 30% of European health budgets, while money spent on brain research is typically only 10% of that spent on all health research.

The present project focuses on interactions between gene activity, synaptic plasticity, and the correlated behavioural learning and memory processes. The social impacts of an interdisciplinary research project clearly designed to increase the basic knowledge about the fundamental processes operating during learning and memory formation, may in the short term, be small. However, beyond its pure scientific aspects, the long-term impact on the public health may be considerable. Shedding light on the basic mechanisms underlying learning and memory will point to realistic models and experimental investigations useful for the study of pathological conditions present in diseases like for example dementia (prevalence 4000-8000/100.000 in European countries - 7 millions with Alzheimer's disease within Europe). The results of the project may also have beneficial effects within the educational systems, providing a framework where pedagogical theories and tools can be optimized. Professor Rawlins is already an invited contributor to OECD symposia that relate advances in neuroscience to the development of educational policy and practice.

By analysing the role played by the GluR-A-subunit of AMPA receptors for LTP appearance in hippocampal and bulbar synapses, the project will focus on a new, highly promising avenue in the search for molecular mechanisms underlying the LTP phenomenon. Hopefully, the new insight will form the basis for pharmacological approaches to facilitate LTP induction and expression. Such results might lead to new drugs for reducing learning difficulties and to slow or reduce memory failure and excitotoxic brain damage. Thus, the improved understanding of genetic, molecular and cellular mechanisms underlying learning and memory processes may, beyond its purely scientific aspect, help in the design of procedures to diagnose, prevent and treat learning and memory impairments in humans. In the light of past achievements, the research collaborators and supervisors in question should be well poised to contribute towards significant advances in this area. Finally, the results can be potentially transferable to the biotechnology, pharmaceutical, and information technology industries.

INFORMATION DISSEMINATION
The results of the project will be disseminated primarily through publications in highly ranked international scientific journals. In the project timetable (see Appendix, p. 10), junctures where it would be natural to summarise and possibly publish the data obtained are indicated with the ! symbol. Along with the doctoral thesis, the results will also be presented at scientific meetings as lectures, abstracts, and posters.

RESOURCES
All the equipment needed for the project to commence is already available, including a comprehensive behavioural testing battery (UK), a state-of-the-art patch-clamping set-up (Norway), and an advanced optical imaging suite (Germany). The only additional cost incurred is that of maintaining a core breeding stock and producing experimental animals for the applicant's behavioural experiments. These costs are estimated at 39,000 NOK per annum, so that maintenance over 3 years is estimated as 97,000 NOK in total. These figures are calculated as follows: In order to conduct proper behavioural analyses of the various mutants, a breeding stock of 120 mice is required at any one time. We intend to test both male and female offspring. Since there is a 50% chance of the offspring being either a suitable mutant or wildtype control, we will aim at a breeding regime that ensures that we have 60 experimental subjects at any one time. The standard cost of food and maintenance per mouse is estimated at approximately 27 NOK per month, resulting in a cost of 325 NOK per mouse per annum. We expect to have to test continuously in the first year, but significantly less in the two following years. Therefore, we have budgeted two years of costs spread unequally over three years. (First year: 100% = 39,000 NOK; Second year: 50% = 29,000; Third year: 50% = 29,000; in total 97,000 NOK).

PROFESSIONAL POSITION
The project forms part of the Behavioural Neuroscience activities within the Department of Experimental Psychology at the University of Oxford. The department has a well-established graduate program in Neuroscience with a range of set courses, extensive library resources and support. With regard to animal work, the department has an exceptional reputation in this field with several renowned experimenters working with both rodents and primates. The animal technicians in the Department are well trained and have extensive experience with transgenic animals. All the work will be undertaken within the collaborative group, which is supported by the European Union Framework 5 Initiative. The collaborative group will permit progress that would otherwise not be possible for any of the research groups working alone. It will bring together the skills and strengths of three major European laboratories: the behavioural skills of Oxford; the electrophysiological skills of Oslo and Heidelberg; and the optical imaging and molecular manipulative skills of Heidelberg. The applicant will gain experience with each of the methods of functional analysis employed within the collaborative group. This will provide exceptional strengths for a future in scientific research, and is an opportunity for bringing an interdisciplinary knowledge base and a network of international contacts with European partner laboratories back into the Norwegian research community.

REFERENCES
Andersen, P, (1991). LTP - an exciting and continuing saga, Pp. xiii - xvii in: Baudry, and M., Davis,
J.(eds.):, Long Term Potentiation. A debate of Current Issues, MIT Press, Cambridge, 454 pp.
Aggleton, J.P, Hunt, P.R. and Rawlins, J.N.P. (1986) The effects of hippocampal lesions upon spatial
and nonspatial tests of working memory. Behavioural Brain Research 19: 133?146.
Bannerman, D.M., Good, M.A., Butcher, S.P., Ramsay, M. and Morris, R.G.M. (1995) Distinct components of spatial learning revealed by prior training and NMDA receptor blockade. Nature 378: 182-186.
Bannerman, D.M., Yee, B.K., Good, M.A., Heupel-Reuter, M.J., Iversen, S.D., and Rawlins, J.N.P. (1999) Double dissociation of function within the hippocampus: a comparison of dorsal, ventral and complete hippocampal cytotoxic lesions. Behavioral Neuroscience 113: 1189-1203.
Barnes, C.A. (1979) Memory deficits associated with senescence: a neurophysiological and behavioral study in the rat. Journal of Comparative Physiology and Psychology 93: 74-104.
Barnes, C.A. (1988) Spatial learning and memory processes: the search for their neurobiological mechanisms in the rat. Trends in Neuroscience 11: 163-169.
Betmouni, S., Deacon R.M.J., Rawlins, J.N.P. and Perry, V.H. (1999) Behavioral consequences of prion disease targetted to the hippocampus in a mouse model of scrapie. Psychobiology 27: 63-71.
Betmouni, S. and Perry, V.H. (1999) Acute inflammatory response in the CNS following the injection of prion brain homogenate and normal brain homogenate. Neuropatholgy and Applied Neurobiology 25: 20-28.
Bliss, T.V.P. and Lømo, T. (1973) Long-lasting potentiation of synaptic transmission in the dentate area of the anaesthetized rabbit following stimulation of the perforant path. Journal of Physiology (London) 232: 331-356.
Bliss, T.V.P. and Richter-Levin, G. (1993) Spatial learning and the saturation of long-term potentiation. Hippocampus 3: 123-126.
Cain, D.P., Hargreaves, E.L., Boon, F. and Dennison, Z. (1993) An examination of the relations between hippocampal long-term potentiation, kindling, afterdischarge, and place learning in the water maze. Hippocampus 3: 153-164.
Carlson, N.R., El?Wakil, F.W., Standish, L.J. and Ormond, D.L. (1976) DRL performance, extinction, and secondary reinforcement: role of appetitive value of food in mice with septal lesions. Journal of Comparative Physiology and Psychology 90: 780?789.
Collingridge G.L., Kehl, S.J. and McLennan, H. (1983) Excitatory amino acids in synaptic transmission in the Schaffer collateral-commissural pathway of the rat hippocampus. Journal of Physiology (London) 334: 33-46.
Gerlai, R. (1998) A new continuous alternation task in T-maze detects hippocampal dysfunction in mice. A strain comparison and lesion study. Behavioral Brain Research 95: 91-101.
Jeffery, K.J. and Morris, R.G.M. (1993) Cumulative long-term potentiation in the rat dentate gyrus correlates with, but does not modify, performance in the water maze. Hippocampus 3: 133-140.
Marighetto, A., Etchamendy, N., Touzani, K., Torrea, C.C., Yee, B.K., Rawlins, J.N.P. and Jaffard, R. (1999) Knowing which and knowing what: a potential mouse model for age?related human declarative memory decline. European Journal of Neuroscience 11: 3312?3322
Mayford, M., Wang, J., Kandel, E.R. and O'Dell, T.J. (1995) CaMKII regulate the frequency-response function of hippocampal synapses for the production of both LTD and LTP. Cell 81: 891-904.
Morris, R.G.M., Garrud, P., Rawlins, J.N.P., and O'Keefe, J. (1982) Place navigation impaired in rats with hippocampal lesions. Nature 297: 681?683.
Morris RG, Anderson E, Lynch GS, Baudry M. (1986) Selective impairment of learning and blockade
of long-term potentiation by an N-methyl-D-aspartate receptor antagonist, AP5. Nature 319: 774-776.
Moser, E.I., Moser, M.B., and Andersen P. (1994) Potentiation of dentate synapses initiated by exploratory learning in rats: dissociation from brain temperature, motor activity, and arousal. Learning and Memory 1: 55-73.
Moser, M.B., Moser, E.I., Forrest, E., Andersen, P. and Morris, R.G.M. (1995) Spatial learning with a minislab in the dorsal hippocampus. Procedures of the Natural Academy Sciences 92: 9697-9709.
Moser, E.I., Krobert, K.A., Moser, M.B., and Morris, R.G.M. (1998) Impaired spatial learning after saturation of long-term potentiation. Science 281: 2038-2042.
O'Keefe, J. and Nadel, L. (1978) The hippocampus as a cognitive map. Oxford University Press, Oxford.
Outram, G.W. (1972) Changes in drinking and feeding habits of mice with experimental scrapie. Journal of Comparative Pathology 82, 415-427.
Rawlins, J.N.P. and Olton, D.S. (1982) The septo?hippocampal system and cognitive mapping. Behavioural Brain Research 5: 331?358.
Richelle, M. (1972) Temporal regulation of behaviour and inhibition. In R.A. Boakes and M.S. Halliday (Eds). Inhibition and Learning. Academic Press, London, pp 229-251.
Richmond, M.A., Yee, B.K., Pouzet, B., Veenman, L., Rawlins, J.N., Feldon, J. and Bannerman, D.M. (1999) Dissociating context and space within the hippocampus: effects of complete, dorsal, and ventral excitotoxic hippocampal lesions on conditioned freezing and spatial learning. Behavioral Neuroscience 113: 1189-1203.
Roder, J.K., Roder, J.C., and Gerlai, R. (1996) Memory and the effect of cold shock in the water maze in S100 beta transgenic mice. Physiology and Behavior 60: 611-615
Sakaguchi, S., Katamine, S., Nishida, N., Moriuchi, R., Shigematsu, K., Sugimoto, T., Nakatani, A., Kataoka, Y., Houtani, T., Shirabe, S., Okada, H., Hasegawa, S., Miyamoto, T., and Noda, T. (1996) Loss of cerebellar Purkinje cells in aged mice homozygous for a disrupted PrP gene. Nature 380: 528-531.
Sinden, J.D., Rawlins, J.N.P., Gray, J.A. and Jarrard, L.E. (1986) Selective cytotoxic lesions of the hippocampal formation and DRL performance in rats. Behavioral Neuroscience 100: 320-329.
Squire, L.R. (1991) Memory and the hippocampus: a synthesis of findings with rats, monkeys, and humans. Psychological Review 99: 195-231.
Sutherland, R.J., Dringenberg, H.C. and Hoesing, J.M. (1993) Induction of long-term potentiation at perforant path dentate synapses does not affect place learning or memory. Hippocampus 3: 141-148.
Tonkiss, J., Morris, R.G. and Rawlins, J.N.P. (1988) Intra-ventricular infusion of the NMDA antagonist AP5 impairs performance on a non-spatial operant DRL task in the rat. Experimental Brain Research 73: 181-188.
van Dellen, A., Blakemore, C., Deacon, R.M.J., York, D. and Hannan, A.J. (2000) Delaying the onset of Huntington's in mice. Nature 404: 721-722.
Willner, P. (1997) Validity, reliability and utility of the chronic mild-stress model of depression: a 10-year review and evaluation. Psychopharmacology (Berlin) 134: 319-329.
Winocur, G., Rawlins, J.N.P. and Gray, J.A. (1987) The hippocampus and conditioning to contextual cues. Behavioral Neuroscience, 101: 617?625.
Wolfer, D.P., Stagljar-Bozicevic, M., Errington, M.L. and Lipp, H.P. (1998) Spatial memory and learning in transgenic mice: fact or artifact? News in Physiological Science 13: 118-123.
Wood, E.R., Dudchenko, P.A., and Eichenbaum, H. (1999) The global record of memory in hippocampal neuronal activity. Nature 397: 613-616.
Zamanillo, D., Sprengel, R., Hvalby, Ø., Jensen, V., Burnashev, N., Rozov, A., Kaiser, K.M., Koster, H.J., Borchardt, T., Worley, P., Lubke, J., Frotscher, M., Kelly, P.H., Sommer, B., Andersen, P., Seeburg, P.H. and Sakmann, B. (1999) Importance of AMPA receptors for hippocampal synaptic plasticity but not for spatial learning. Science 284: 1805-1811.
Zeidler, M., Stewart, G.E., Barraclough, C.R., Bateman, D.E., Bates, D., Brun, D.J., Colchester, A.C., Durward, W., Fletcher, N.A., Hawkins, S.A., Mackenzie, J.M., and Will, R.G. (1997) New variant Creutzfeldt-Jakob disease: neurological features and diagnostic tests. Lancet 350: 903-907.